Duration of the activity: 30 minutes
Recommended age: 12 years old and above
Population GenomicsMedical Data science
It makes a difference
– Your turn to play
Genetic variation can sometimes have surprising effects...
Context
We are all different. Some of these differences are clearly visible and obvious, such as eye colour or hair texture, while others are invisible, such as blood type or our ability to resist to a virus.
These differences are mainly the result of genetic variations in our DNA, at the heart of our chromosomes. The human genome is made up of 3 billion nucleotides. Around 1 nucleotide in 1000 differs between 2 individuals.
Here is a DNA sequence located on chromosome 12. Find the genetic variation: Individual 1: ...accctttcaagctgaaagcaacagtgcagacgatgaga... Individual 2: ...accctttcaggctgaaagcaacagtgcagacgatgaga...
It’s up to you to discover the impact of some popular and well-described genetic variations!
To do this, you will search for the information associated with a DNA sequence in a database.
The genetic variations you are going to explore are well characterised: a single nucleotide differs and is responsible for the phenotypic trait in question. This is not often the case!
We do not yet know the impact of many genetic variations. A particular phenotype (such as eye colour or hair texture) is generally the result of a combination of several genetic variations. Some diseases are the result of a combination of several hundred genetic variations… and the environment plays a key role!
Select a DNA sequence
Copy/paste (or type) this sequence into the search box. Try not to select the same sequence twice!
X
No information is available at this time. We don't know everything! Researchers are working hard to try and find the impact of some 10 million genetic variations!
accctttcaagctgaaagcaacagtgcagacgatgaga
cactctaagattttctgcttagcattaatgacattttg
gaggctgaccgagagcgaggtgccatcatgggcatcca
cactctaagattttctgcttagcattaatgacattttg
accctttcaggctgaaagcaacagtgcagacgatgaga
cactctaagattttctgcttagcattaatgacattttg
ggaaggatgtcctcgtggtgaccccttggctggctccc
cactctaagattttctgcttagcattaatgacattttg
cgccacccgctgaactggatcctggtgaacctggcggt
cactctaagattttctgcttagcattaatgacattttg
tgacccttccacgcctctctcaggtcttgcactgcacg
cactctaagattttctgcttagcattaatgacattttg
tgggcatctgcttctgcattgccagtgtactcgggcca
tgacccttccacgcctgtctcaggtcttgcactgcacg
gaggctgactgagagcgaggtgccatcatgggcatcca
acgggctgcaggcatacactaaagtgaaaactgtgagt
cactctaagattttctgcttagcattaatgacattttg
ccgaggcctacagattttgatcccttctctatcccatt
cactctaagattttctgcttagcattaatgacattttg
cgccacccgctgaactggatcctggtgaaactggcggt
acgggctgcaggcatacactgaagtgaaaactgtgagt
cactctaagattttctgcttagcattaatgacattttg
ggaaggatgtcctcgtggtaccccttggctggctccc
ccgaggcctacagcttttgatcccttctctatcccatt
cactctaagattttctgcttagcattaatgacattttg
tgggcatctgcttctgcattgccagtgtactcaggcca
Search the database
DNA sequence(chromosome 12)
accctttcaagctgaaagcaacagtgcagacgatgaga
OAS1 gene which codes for a protein involved in the protection against certain viruses.
Individuals with 'a' appear to be less resistant to severe forms of COVID-19.
DNA sequence (chromosome 12)
accctttcaggctgaaagcaacagtgcagacgatgaga
OAS1 gene which codes for a protein involved in the protection against certain viruses.
Individuals with 'g' appear to be more resistant to severe forms of COVID-19.
Chromosome 12: OAS1 rs10774671; several variations; UniProtKB: P00973
Resistance to SARS-CoV-2
Numerous genetic variations have been associated with susceptibilities to develop more or less severe forms of COVID-19.
We might have inherited some of them from Neanderthal!
DNA sequence (chromosome 12)
acgggctgcaggcatacactaaagtgaaaactgtgagt
ALDH2 gene which codes for a protein in our liver that breaks down the alcohol we drink.
Individuals with 'a' suffer from 'Asian blush syndrome' and have a very poor tolerance of alcohol. This variation is more common in Asia!
Chromosome 12: ALDH2 rs671; UniProtKB: P05091
DNA sequence (chromosome 12)
acgggctgcaggcatacactgaagtgaaaactgtgagt
ALDH2 gene which codes for a protein in our liver that breaks down the alcohol we drink.
Individuals with a 'g' 'digest' alcohol normally. But alcohol abuse is still dangerous for your health!
Chromosome 12: ALDH2 rs671; UniProtKB: P05091
Alcohol intolerance
ADH proteins serve to break down alcohols, including ethanol, an alcohol found in alcoholic beverages or fermented foods.
These proteins are present in many species, and genetic variations can alter their function.
DNA sequence (chromosome 11)
ccgaggcctacagattttgatcccttctctatcccatt
OR6A2 gene coding for a protein which is an olfactory receptor.
Individuals with a 'a' don't like coriander: they find this spice tastes like soap!
Chromosome 11: OR6A2 rs72921001; UniProtKB: O95222
DNA sequence (chromosome 11)
ccgaggcctacagcttttgatcccttctctatcccatt
OR6A2 gene coding for a protein which is an olfactory receptor.
Individuals with a 'c' are fans of coriander.
Chromosome 11: OR6A2 rs72921001; UniProtKB: O95222
Flavours and odours
The ability to detect and differentiate between tastes and odours is an important evolutionary adaptive advantage for many species. It enables the identification of odours associated with food, sexual partners, predators and other important aspects of the environment.
Source: A genetic variant near olfactory receptor genes influences cilantro preference (2012
DNA sequence (chromosome X)
cgccacccgctgaactggatcctggtgaaactggcggt
OPN1MW gene encoding a photoreceptor protein present in the retina, involved in colour recognition.
Individuals with 'a' cannot differentiate red from green (colour blindness).
This is the form of colour blindness that John Dalton suffered from: the diagnosis was confirmed in 1995, more than 150 years after his death, thanks to an analysis of his DNA.
DNA sequence (chromosome X)
cgccacccgctgaactggatcctggtgaacctggcggt
OPN1MW gene encoding a photoreceptor protein present in the retina, involved in colour recognition.
Individuals with a 'c' have normal colour vision.
Colour vision
Colour vision is thought to have appeared in the first agnathan vertebrates over 540 million years ago. Primates are the only mammals to be able to detect the 3 basic colours (trichromy).
Source: Novel missense mutations in red/green opsin genes in congenital color-vision deficiencies (2002)
DNA sequence (chromosome 11)
gaggctgaccgagagcgaggtgccatcatgggcatcca
ACTN3 gene which codes for a protein expressed mainly in fast-twitch muscle fibres.
The 'c' variation is found more frequently in 'elite sprinter' athlete population than in the general population.
Chromosome 11: ACTN3 rs1815739; UniProtKB: Q08043
DNA sequence (chromosome 11)
gaggctgactgagagcgaggtgccatcatgggcatcca
ACTN3 gene which codes for a protein expressed mainly in fast-twitch muscle fibres.
Individuals with a 't' do not produce the ACTN3 protein: they have more slow twitch muscle fibres.
Around 18% of the human population lacks the ACTN3 protein.
This genetic variation is more frequently found in endurance athletes (e.g. cyclists and long-distance runners).
Chromosome 11: ACTN3 rs1815739; UniProtKB: Q08043
The speed gene?
The influence of genetics on sport performance is the subject of much study and debate.
Some 200 genes influence sport performance, and more than 20 genetic variations could condition the status of the elite athlete.
DNA sequence (chromosome 9)
ggaaggatgtcctcgtggtgaccccttggctggctccc
ABO gene coding for a protein that adds sugars to red blood cells. The blood group will be different depending on the sugar added.
Individuals with a 'g' have blood group A, B or AB.
Chromosome 9: ABO rs1556058284; several variations; UniProtKB: P16442
DNA sequence (chromosome 9)
ggaaggatgtcctcgtggt.accccttggctggctccc
ABO gene coding for a protein that adds sugars to red blood cells. The blood group will be different depending on the sugar added.
Individuals with this sequence (missing a 'g') have blood group O.
Blood group O is the most common in the world (between 30% and 80% of the population depending on the region).
Chromosome 9: ABO rs1556058284; several variations; UniProtKB: P16442
ABO blood types
Blood groups A, B, AB and O were discovered at the beginning of the 20th century.
Why is there so much diversity in the human population?
DNA sequence (chromosome 2)
tgacccttccacgcctctctcaggtcttgcactgcacg
EPAS1 gene encoding a protein that regulates the response to oxygen deprivation (hypoxia) and adaptation to altitude.
Individuals with a 'c' are not particularly well adapted to altitude.
Chromosome 2: EPAS1; several variations; UniProtKB: Q99814
DNA sequence (chromosome 2)
tgacccttccacgcctgtctcaggtcttgcactgcacg
EPAS1 gene encoding a protein that regulates the response to oxygen deprivation (hypoxia) and adaptation to altitude.
Individuals with a 'g' are well adapted to altitude.
Chromosome 2: EPAS1; several variations; UniProtKB: Q99814
Altitude
This genetic variation is extremely rare. It appears to have appeared 8,000 years ago in Tibet and protects the inhabitants against altitude sickness (at altitudes of over 4,000 metres, oxygen levels drop by 40%). Other genetic variations in this gene are associated with adaptation to altitude: they are all inherited from Denisova man.
Source: The history and evolution of the Denisovan- EPAS1 haplotype in Tibetans (2021)
DNA sequence (chromosome 16)
tgggcatctgcttctgcattgccagtgtactcaggcca
MRP8 gene which codes for a protein involved in the production of sweat and earwax.
Individuals with a 'a' have a 'dry' earwax and a faint odour of perspiration.
This genetic variation is found more frequently in Asia.
Chromosome 16: MRP8 rs17822931; UniProtKB: Q96J66
DNA sequence(chromosome 16)
tgggcatctgcttctgcattgccagtgtactcgggcca
MRP8 gene which codes for a protein involved in the production of sweat and earwax.
Individuals with a 'g' have a 'wet' earwax and a strong smell of sweating.
Chromosome 16: MRP8 rs17822931; UniProtKB: Q96J66
Dry or wet earwax?
Earwax helps clean and lubricate the ear canal, and offers protection against bacteria, fungi, dust and water.
Genetic variation determines the type of earwax in the human population: wet or dry.
