Skip to main content
Yellow dots

Hunt for variants
- Your turn to play

A new variant is here!
Find the differences, their impact and retrace the evolution of the coronavirus.

Duration of the activity: 30 minutes
Recommended age: 15 years old and above
Population geneticsMedical Data Science

hunt-for-variants

Activity 1

Find the differences!

Every time SARS-CoV-2 infects human cells, millions of copies of the virus, and thus of its genetic material, are produced…and those copies are not always identical!

Here are 3 small pieces of the genetic material of SARS-CoV-2:
the original and those found in two different copies (variant 1 and variant 2), coming from two different cities.

originalggtttccaacccactaatggtgttggttac
variant 1ggtttccaacccacttatggtgttggttac
variant 2ggcttccaacccactaacggtgttggttac
?

Question 1

How many differences are there?

Answer

There are 3 differences (in green):

For those who are motivated…

Here is the alignment of the ‘original’ SARS-COV-2 genome with the genome of the variant Alpha :

Have fun counting the differences between these two sequences of 29’903 nucleotides…

Hint: The presence of a * means there is no difference, the presence of a – means a letter is missing.

Activity 2

One difference can make all the difference!

The genetic material of the virus contains all the recipes to make proteins. The differences (called mutations) found in the genetic material of virus variants can modify the proteins produced using these recipes…but not always.

One protein present at the surface of the virus, the spike protein, is particularly monitored by scientists. It’s this protein that enables the virus to enter human cells and it’s also this protein that is recognized by the antibodies we produce to fight the virus!

Depending on the differences, the virus could become more infectious or even escape the immune response provoked by a vaccine.

Translate the 3 nucleotide sequences into amino acid sequences using the genetic code:
add the missing amino acids in the sequence of the spike protein

The genetic code
3 nucleotide letters (A,T,C,G) correspond to a single amino acid letter (G,E,N,I,A, L, ...)
To translate, start from the centre and work outwards.
Example : GGT -> G

POSITION498497498499500501502503504505
nucleotides (original)ggtttccaacccactaatggtggtggttac
amino acids (original)GFQPTNGVGY
nucleotides (variant 1)ggtttccaacccacttatggtggtggttac
amino acids (variant 1)GGVGY
nucleotides (variant 2)ggcttccaacccactaacggtgttggttac
amino acids (variant 2)PGVY

Check

I give up!

?

Question 2

How many differences are there between the protein sequences?

Compare it to the number of differences in Question 1…

Answer

There are 3 differences between the nucleotide sequences (in green) but only 1 difference between the amino acid sequences: N -> Y (in red).

A mutation in the nucleotide sequence does not necessarily modify the amino acid sequence of the corresponding protein, since the genetic code is ‘redundant’. Fortunately!

…496 497 498 499 500 501 502 503 504 505…
nucleotides (original) ggt ttc caa ccc act aat ggt gtt ggt tac
amino acids (original) G F Q P T N G V G Y
nucleotides (variant 1) ggt ttc caa ccc act tat ggt gtt ggt tac
amino acids (variant 1) G F Q P T Y G V G Y
nucleotides (variant 2) ggc ttc caa ccc act aac ggt gtt ggt tac
amino acids (variant 2) G F Q P T N G V G Y

The mutation N->Y is found in the virus ‘variant 1’ at position 501 in the amino acid sequence of the spike protein: it is called N501Y.

This mutation could have an impact on the capacity of SARS-CoV-2 to infect human cells, as it is localised in the region of the spike protein that binds to human cells.

Activity 3

Track the evolution of the virus…

Here is a very schematized representation of the genetic material of SARS-CoV-2, each with a different combination of mutations (rectangles of different colours). Variant F is the sequence of the ‘original’ virus.

The order in which the different mutations appear can be represented by a tree. The red mutation, present in all the virus variants, probably appeared first (variant E), then the yellow mutation (variant C),…

?

Question 3

Which is the best solution?

Here are the nucleotide sequences of 5 virus variants. Which tree showing the order of appearance of the mutations seems to be correct?

Answer

The correct answer is ‘Solution B’ and ‘Solution C’: these 2 trees are identical: the top branch, a bit like a mobile, has been inversed.

The variant 4 probably appeared before the others!

Activity 4

Here is a SARS-CoV-2 nucleotide sequence found in the wastewater in a treatment plant of a Swiss ski resort at the beginning of December 2020:

position 496 … … … … … … … … 505
codon ggt ttc caa ccc act tat ggt gtt ggt tac

Is the mutation N501Y present? Could it possibly be the variant Alpha?

Hint: Use the genetic code and translate the nucleotide sequence…

Answer & Explanation

Here is the respective positions of the different codons and amino acids in the sequence of the spike protein:

position 496 497 498 499 500 501 502 503 504 505
codon ggt ttc caa ccc act tat ggt gtt ggt tac
amino acids
G F Q P T Y G V G Y

The protein sequence contains the amino acid Y at position 501, corresponding to the famous mutation N501Y.

For the anecdote, this mutation, as well as several other mutations present in the variant Alpha, were found in the wastewater from Lausanne and a Swiss ski resort. These samples had been collected between July and December 2020. There results suggest that variant Alpha could already have been circulating in Switzerland at the beginning of December 2020. This variant was officially discovered in Great Britain at the beginning of December 2020!

Source:
Detection and surveillance of SARS-CoV-2 genomic variants in wastewater (2021)
Surveillance of SARS-CoV-2 genomic variants in wastewater
V-pipe: A bioinformatics pipeline for viral sequencing data