//show holiday modal during set period and only once Skip to main content
Yellow dots

Jagd auf Varianten
– Jetzt sind Sie dran

Eine neue Variante ist da!
Finden Sie die Unterschiede, ihre Auswirkungen und verfolgen Sie die Entwicklung des Coronavirus.

Dauer der Aktivität: 30 Minuten
Altersempfehlung: ab 15 Jahren
Population geneticsMedical Data Science

Die Suche nach Varianten

Aktivität 1

Findet die Unterschiede!

Jedes Mal, wenn SARS-CoV-2 menschliche Zellen infiziert, werden Millionen Kopien des Virus und damit seines genetischen Materials produziert…und diese Kopien sind nicht immer identisch!

Hier sind 3 kleine Stücke des genetischen Materials von SARS-CoV-2:
das Original und zwei verschiedene Kopien (Variante 1 und Variante 2), die aus zwei verschiedenen Städten stammen.

originalggtttccaacccactaatggtgttggttac
variant 1ggtttccaacccacttatggtgttggttac
variant 2ggcttccaacccactaacggtgttggttac
?

Frage 1

Wie viele Unterschiede gibt es?

Antwort

Es gibt 3 Unterschiede (in grün):

Für Motivierte…

Hier ist der Vergleich des ‘ursprünglichen’ SARS-COV-2-Genoms mit dem Genom der Variante Alpha :

Viel Spaß beim Zählen der Unterschiede zwischen diesen beiden Sequenzen von 29’903 Nukleotiden…

Hinweis: Das Vorhandensein eines * bedeutet, dass es keinen Unterschied gibt, das Vorhandensein eines – bedeutet, dass ein Buchstabe fehlt.

Aktivität 2

Ein einzelner Unterschied kann grosse Auswirkungen haben!

Das genetische Material des Virus enthält alle Rezepte zur Herstellung von Proteinen. Die im genetischen Material von Virusvarianten gefundenen Unterschiede (Mutationen genannt) können die mit diesen Rezepten hergestellten Proteine modifizieren…aber nicht immer.

Ein Protein, das an der Oberfläche des Virus vorhanden ist, das Spike-Protein, wird von Wissenschaftlern besonders überwacht. Es ist dieses Protein, das es dem Virus ermöglicht, in menschliche Zellen einzudringen, und es ist auch dieses Protein, das von den Antikörpern erkannt wird, die wir produzieren, um das Virus zu bekämpfen!

Je nachdem welche Unterschiede auftreten, könnte das Virus infektiöser werden oder sogar der durch einen Impfstoff hervorgerufenen Immunantwort entkommen.

Übersetzen Sie die 3 Nukleotidsequenzen mithilfe des genetischen Codes in Aminosäuresequenzen:
Fügen Sie die fehlenden Aminosäuren in der Sequenz des Spike-Proteins hinzu

Der genetische Code
3 Nukleotidbuchstaben (A,T,C,G) entsprechen einem einzelnen Aminosäurebuchstaben (G,E,N,I,A, L, ...)
Beginnen Sie beim Übersetzen in der Mitte und arbeiten Sie sich nach außen vor.
Beispiel: GGT -> G

POSITION498497498499500501502503504505
nucleotides (original)ggtttccaacccactaatggtggtggttac
amino acids (original)GFQPTNGVGY
nucleotides (variant 1)ggtttccaacccacttatggtggtggttac
amino acids (variant 1)GGVGY
nucleotides (variant 2)ggcttccaacccactaacggtgttggttac
amino acids (variant 2)PGVY

Prüfen

Ich gebe auf!

?

Frage 2

Wie viele Unterschiede gibt es zwischen den Proteinsequenzen?

Vergleichen Sie es mit der Anzahl der Unterschiede in Frage 1…

Antwort

Es gibt 3 Unterschiede zwischen den Nukleotidsequenzen (in grün), aber nur 1 Unterschied zwischen den Aminosäuresequenzen: N -> Y (in rot).

Eine Mutation in der Nukleotidsequenz verändert nicht unbedingt die Aminosäuresequenz des entsprechenden Proteins, da der genetische Code ‘redundant’ ist. Glücklicherweise!

…496 497 498 499 500 501 502 503 504 505…
nucleotides (original) ggt ttc caa ccc act aat ggt gtt ggt tac
amino acids (original) G F Q P T N G V G Y
nucleotides (variant 1) ggt ttc caa ccc act tat ggt gtt ggt tac
amino acids (variant 1) G F Q P T Y G V G Y
nucleotides (variant 2) ggc ttc caa ccc act aac ggt gtt ggt tac
amino acids (variant 2) G F Q P T N G V G Y

Die Mutation N->Y findet sich in der Virus ‘Variante 1’ an Position 501 in der Aminosäuresequenz des Spike-Proteins: Sie heißt N501Y.

Diese Mutation könnte sich auf die Fähigkeit von SARS-CoV-2 auswirken, menschliche Zellen zu infizieren, da es in der Region des Spike-Proteins lokalisiert ist, das an menschliche Zellen bindet.

Aktivität 3

Verfolgen Sie die Entwicklung des Virus…

Hier ist eine sehr schematisierte Darstellung des genetischen Materials von SARS-CoV-2, jeweils mit einer anderen Kombination von Mutationen (Rechtecke unterschiedlicher Farbe). Variante F ist die Sequenz des ‘ursprünglichen’ Virus.

Die Reihenfolge, in der die verschiedenen Mutationen auftreten, kann durch einen Baum dargestellt werden. Die rote Mutation, die in allen Virusvarianten vorhanden ist, trat wahrscheinlich zuerst auf (Variante E), dann die gelbe Mutation (Variante C),…

?

Frage 3

Welches ist die beste Lösung?

Hier sind die Nukleotidsequenzen von 5 Virusvarianten. Welcher der Bäume, die die Reihenfolge des Auftretens der Mutationen zeigen, scheint richtig zu sein?

Antwort

Die richtige Antwort ist ‘Lösung B’ und ‘Lösung C’. Diese beiden Bäume sind identisch: der oberste Zweig, ein bisschen wie ein Handy, wurde umgedreht.

Die Variante 4 ist wohl vor den anderen erschienen!

Aktivität 4

Hier ist eine SARS-CoV-2-Nukleotidsequenz, die Anfang Dezember 2020 im Abwasser einer Kläranlage eines Schweizer Skigebiets gefunden wurde:

position 496 505
codon ggt ttc caa ccc act tat ggt gtt ggt tac

Ist die Mutation N501Y vorhanden? Könnte es vielleicht die Variante Alpha sein?

Tipp: Verwenden Sie den genetischen Code und übersetzen Sie die Nukleotidsequenz… 

Antwort & Erläuterung

Hier die jeweiligen Positionen der verschiedenen Codons und Aminosäuren in der Sequenz des Spike-Proteins:

position 496 497 498 499 500 501 502 503 504 505
codon ggt ttc caa ccc act tat ggt gtt ggt tac
amino acids
G F Q P T Y G V G Y

Die Proteinsequenz enthält an Position 501 die Aminosäure Y, die der berühmten Mutation N501Y entspricht.

Anekdote: Diese Mutation sowie mehrere andere in der Variante Alpha vorhandene Mutationen wurden im Abwasser von Lausanne und einem Schweizer Skigebiet gefunden. Diese Proben wurden zwischen Juli und Dezember 2020 gesammelt. Ihre Ergebnisse deuten darauf hin, dass die Variante Alpha bereits Anfang Dezember 2020 in der Schweiz im Umlauf gewesen sein könnte. Diese Variante wurde Anfang Dezember 2020 in Grossbritannien offiziell entdeckt!

Quelle:
Detection and surveillance of SARS-CoV-2 genomic variants in wastewater (2021)
Surveillance of SARS-CoV-2 genomic variants in wastewater
V-pipe: A bioinformatics pipeline for viral sequencing data
Print Friendly, PDF & Email