//show holiday modal during set period and only once Skip to main content
DNA Icon Sequence Icon Icon

Ein Bisschen Biologie

Hintergrund
10 bis 100 Millionen verschiedene Arten leben auf unserem Planeten.
Die Quelle dieser Vielfalt ist die Evolution: Alle Arten sind in unterschiedlichem Masse miteinander verwandt. Innerhalb jeder Art  verändern sich die Individuen über Generationen hinweg durch zufällige Veränderungen in ihrer DNA, sogenannte Mutationen.
Diese Mutationen können dazu beitragen, dass ein Individuum Vor- oder Nachteile in seinem Leben erfährt, entsprechend seiner Umwelt und der Wechselwirkungen zwischen verschiedenen Arten und Individuen. Und manchmal taucht ein neues Merkmal oder sogar eine neue Art auf, die besser an ihre Umgebung angepasst ist.
Um den Grad der Verwandtschaft zu bestimmen, untersuchen Biologen, was Arten gemeinsam haben, aber auch, was sie unterscheidet. Die Verwandtschaftsbeziehungen zwischen den verschiedenen Arten werden meistens in Form eines Baumes dargestellt, der als „Stammbaum“ oder „Baum des Lebens“ bezeichnet wird.
Zu Darwins Zeiten begannen die Menschen, Arten anhand ihrer Morphologie zu vergleichen – sie analysierten zum Beispiel Größe, Form und Struktur von Knochen, das Vorhandensein von Haaren oder Schuppen oder bei Pflanzen die Anordnung von Blättern an einem Stängel. Je ähnlicher die morphologischen Merkmale zweier Arten sind, desto jünger ist ihr letzter gemeinsamer Vorfahre.
Heute ist es möglich, die Evolution von Arten zu studieren, indem man ihre DNA und insbesondere ihre Gene oder ihre Proteine ​​vergleicht. Je ähnlicher die DNA zweier Arten ist, desto jünger ist ihr letzter gemeinsamer Vorfahre.

Wie werden Proteine ​​hergestellt, diese unglaublichen kleinen Lebensmaschinen, die für das reibungslose Funktionieren aller Organismen unerlässlich sind? Was ist der Zusammenhang zwischen DNA, Genen, Proteinen und Evolution?

Was ist DNA? Was ist ein Gen? Was ist ein Protein? Wie sehen diese Daten heute aus? 

Zelle, Chromosom und DNA 

Alle lebenden Organismen bestehen aus Zellen. 

 

Wer hat die meisten Zellen?

Organismus  Bakterium
E.coli
Nematode
C.elegans
Erdbeere  Schimpanse Mensch
Anzahl der Zellen 1 1,000 ein paar Millionen ~100’000 Milliarden ~100’000 Milliarden
Icon Bacterie Icon Worm Icon Strawberry Icon Monkey Icon Human
Quelle:
Post-embryonic cell lineages of the nematode, Caenorhabditis elegans (1977)
Cell count and size in relation to fruit size among strawberry cultivars (1992)
An estimation of the number of cells in the human body (2013)

Jede Zelle enthält Chromosomen.

Wer hat die meisten Chromosomen?

Organismus

Bakterium

E.coli

Goldfisch
Farn
Farn Ophioglossum
Schimpanse Mensch Banane

australische Ameise

Chromosomenzahl (2n)

1

100 1,440 48
46
11

1 or 2*

Icon Bacterie Icon Fish Icon Fougère Icon Monkey Icon Human Icon Banana Icon Fourmi
*Die diploiden Weibchen haben 2 Chromosomen; die Männchen, haploid, haben nur ein Chromosom.
Quelle: wikipedia

Chromosom, DNA und Genom

Ein Chromosom kann mit einem mehr oder weniger kompakten Knäuel verglichen werden, dessen Faden die DNA repräsentiert.

Adapted from Wikimedia Commons

DNA hat meistens eine charakteristische „Doppelhelix“-Struktur, die aus zwei Strängen besteht. Jeder Strang ist ein langes Molekül, das aus einer Folge von 4 Nukleotiden besteht, die A (Adenin), T (Thymin), G (Guanin) und C (Cytosin) genannt werden. Die 2 Stränge ergänzen sich:
Ein A in einem Strang steht einem T in dem anderen Strang gegenüber, ein G steht einem C gegenüber. 

DNA ist universell: Sie kommt in allen lebenden Organismen vor! Sie kommt auch in bestimmten Viren vor, manchmal in etwas anderer Form (einzelsträngige DNA). 

Welche Sequenz hat das Bananen-Chromosom 3? Wie lang ist das menschliche Chromosom 1 in Zentimetern?

Beginn der Sequenz des Bananen-Chromosoms 3 (Gesamtlänge: 30.470.407 bp; 1 cm).

Wenn Sie auf den Link klicken, haben Sie Zugriff auf die vollständige Sequenz. 

>NC_025204.1
ACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAA
ACCCTAAACCCTAAACCCTAAAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCT
AAACCCTAAACCCTAAAACCAAAAAAAATGGAATAATTACTTTAAATCTTAATTATTCCTTTATTTTTGT
TTTTTTTTTTTTTAATCTTGATGCCCGATTACCCGATATGTCGGCTGGGCGGGCGCTTGGACATTGCGCT
CGTTGGGCCCAACCTGTGCTGGGCTTTTGCGTCGGCCTTTTCAATGTACTGGGTCAAACCTGAGTCATGA...

Beginn der Chromosomensequenz des Bakteriums E.coli (Gesamtlänge: 4.646.332 bp; 0,15 cm) 

>AP009048.1
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAA
TATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC
ATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAG
CCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA...

Ein Stück der Sequenz des menschlichen Chromosoms 1 (Gesamtlänge: 248.956.422 bp; 8,2 cm). 

>CM000663.2
GGTAGAACCTCAGTAATCCGAAAAGCCGGGATCGACCGCCCCTTGCTTGCAGCCGGGCACTACAGGACCC
GCTTGCTCACGGTGCTGTGCCAGGGCGCCCCCTGCTGGCGACTAGGGCAACTGCAGGGCTCTCTTGCTTA
GAGTGGTGGCCAGCGCCCCCTGCTGGCGCCGGGGCACTGCAGGGCCCTCTTGCTTACTGTATAGTGGTGG
CACGCCGCCTGCTGGCAGCTAGGGACATTGCAGGGTCCTCTTGCTCAAGGTGTAGTGGCAGCACGCCCAC
CTGCTGGCAGCTGGGGACACTGCCGGGCCCTCTTGCTCCAACAGTACTGGCGGATTATAGGGAAACACCC...

Hinweis: In den Sequenzen kann auch ‹N› gefunden werden: Dies bedeutet, dass die Nukleotide während der Sequenzierung nicht identifiziert wurden. 

Die Größe des Genoms, die meistens in Basenpaaren (bp) oder in Millionen von Basen (Mb) ausgedrückt wird, ist von Organismus zu Organismus sehr unterschiedlich. Und es ist nicht immer der Organismus, den wir glauben, dass er das größte Genom hat!

Wer hat das größte Genom?

Organismus
Bakterium
E.coli
v
Virus

SARS-CoV-2
Fliege Pflanz
Paris japonica
Mensch Banane
size of the genome (bp) 4,646,332 29,903 143 Millionen
150 Milliarden 3 Milliarden 472 Milliarden
Icon Bacterie Icon Virus Icon Mouche Icon Paris Icon Human Icon Banana
Hinweis: Dies ist die Grösse des „haploiden“ Genoms: Beim Menschen beispielsweise entsprechen 3 Milliarden bp der Sequenz von 23 Chromosomen.
Quelle:
E.coli: NCBI Genome; SARS-COV-2: NCBI Genome; Drosophila Melanogaster: NCBI Genome; Paris japonica: Harvard bionumbers; Homo sapiens: NCBI Genome; Banana: NCBI Genome

Warum ist es so wichtig, die Sequenz des Genoms zu kennen? 

Genome enthalten die Informationen, die für den Aufbau von Organismen und insbesondere für den Aufbau von Proteinen, diesen unglaublichen kleinen lebenden Maschinen, die für das reibungslose Funktionieren aller Organismen unerlässlich sind, erforderlich sind … 

DNA und Gene

Die DNA ist der Träger der Erbinformation: Die Reihenfolge, in der die Nukleotide verknüpft sind, ist äußerst wichtig. Ähnlich wie ein Kochbuch enthält die DNA eine Reihe von Rezepten, die „Gene“ genannt werden. Wir werden uns die Gene ansehen, die für Proteine ​​kodieren. 

Das Gen = ein Rezept zur Herstellung von einem (oder mehreren) Protein(en) 

 

Wer hat die meisten Protein-kodierenden Gene?

Organismus
Bakterium
E.coli
Nematode
C.elegans
Banane Schimpanse Mensch
Anzahl der Gene (Proteine) 4,140 20,356 36,439 23,534 20,430
Icon Bacterie Icon Worm Icon Banana Icon Monkey Icon Human
Die Anzahl der Gene variiert je nach Quelle und kann sich im Laufe der Zeit ändern! 
Quelle:
E coli: OMA; C. elegans: OMA; Chimp: OMA; Human: OMA; Banana: OMA

Hier ist ein DNA-Stück auf dem menschlichen Chromosom 11, das dem Gen entspricht, das für das Protein Insulin kodiert.

In Eukaryoten sind Gene nicht „kontinuierlich“: Sie bestehen aus kodierenden Regionen, Exons (in Rot), die in die Aminosäuresequenz übersetzt werden, und nicht kodierenden Regionen (Introns). Während der Proteinsynthese werden Introns entfernt.

Proteine

Proteine ​​sind lebensnotwendig für alle Zellen und alle Organismen!

Comics: A protein? A what?

Wenn die Zelle oder der Organismus ein Protein benötigt, wird zunächst das entsprechende Gen kopiert.

Die Kopie, Boten-RNA (mRNA, Messenger-RNA) genannt, wird dann an Ribosomen weitergegeben, Protein-produzierende Maschinen, die sich in allen Zellen befinden.

Ein Gen kann für mehrere Proteine kodieren

RNA durchläuft einen Reifungsprozess, der insbesondere zur Eliminierung von Introns führt. Dieser Vorgang wird als „Spleissen“ bezeichnet. 

Es kann alternativ sein: Die Kombination der am Ende vorhandenen Exons kann je nach mRNA unterschiedlich sein. Ein Gen kann verschiedene mRNAs produzieren … und damit verschiedene Proteine. 

Eines der extremsten Beispiele ist das Dscam-Gen aus Drosophila: Dieses eine Gen besteht aus 95 alternativen Exons und kann bis zu 38.000 verschiedene Proteine ​​produzieren, also mehr verschiedene Proteine ​​als Gene im Genom!
(Quelle: Role of RNA secondary structures in regulating Dscam alternative splicing (2019)).

In Evolutionsstudien auf molekularer Ebene assoziieren Biologen jedes Gen mit einem repräsentativen Protein („kanonisches“ oder Konsensus-Protein). Dies ist der (nicht-biologische!) Grund, warum die Wörter Gen oder Protein sehr oft austauschbar verwendet werden, um über ein Gen oder Protein zu sprechen, das verschiedenen Arten gemeinsam ist! 

Das Ribosom übersetzt die Nukleotidsequenz der Boten-RNA in Aminosäuresequenzen und ermöglicht so die Entstehung eines Proteins.

Proteine ​​bestehen aus einer Kette von Aminosäuren. Es gibt 20 verschiedene Aminosäuren, die wie Nukleotide auch durch Buchstaben (G, E, N, I, A, L, …) symbolisiert werden: 3 Buchstaben von Nukleotiden (ein Codon) entsprechen einem Buchstaben einer Aminosäure.

Biologen verwenden den genetischen Code, um eine Sequenz von Nukleotiden in eine Sequenz von Aminosäuren zu übersetzen. Hier ist eine Darstellung des genetischen Codes, der von der Mitte nach außen gelesen werden muss. Zum Beispiel kodiert das GTG-Codon für die Aminosäure V (Val, Valin).

Einmal synthetisiert, faltet sich die Kette von Aminosäuren, um eine 3D-Struktur anzunehmen, die für sie spezifisch ist und die für das ordnungsgemäße Funktionieren des Proteins vonnöten ist.

Hier sind verschiedene Darstellungen der 3D-Struktur des BRAF-Proteins, bestehend aus 766 Aminosäuren, mit der Position der Aminosäuren: L, A, T, V, K. .

Proteine ​​und biologische Funktionen 

Proteine ​​gibt es in einer Vielzahl von Größen, Formen und Funktionen.

Einige Proteine ​​kommen nur in bestimmten Arten vor:
- an der Photosynthese beteiligte Proteine ​​beispielsweise kommen nur in Pflanzen, Algen und Cyanobakterien vor;
- am Sehen beteiligte Proteine ​​sind in Pflanzen, Algen oder Cyanobakterien nicht vorhanden...

Die in einer Mehrzahl von Arten vorkommenden Proteine ​​sind an universellen biologischen Prozessen wie beispielsweise der Proteinsynthese oder der DNA-Replikation beteiligt.

Diese Proteine ​​(oder die entsprechenden Gene) sind sehr nützlich für das Studium der Evolution!

Print Friendly, PDF & Email