DNA Icon Sequence Icon Icon

Un peu de biologie

Le contexte
10 à 100 millions d’espèces peuplent notre planète.
L’évolution est à l’origine de cette diversité: toutes les espèces sont apparentées à des degrés divers. Au sein de chaque espèce, les individus évoluent au fil des générations grâce à des changements qui surviennent de façon aléatoire dans leur ADN.
Ces changements (mutations) vont être sélectionnés, a posteriori, en fonction de l’environnement et de l’interaction des espèces et des individus entre eux. Et parfois, une nouvelle caractéristique voire une nouvelle espèce apparaît, mieux adaptée à son environnement.
Pour définir les liens de parenté, les biologistes recherchent ce que les espèces ont en commun mais aussi ce qui les distingue. Les liens de parenté entre les différentes espèces sont représentés le plus souvent sous forme d’un arbre, appelé ‘arbre phylogénétique’ ou ‘arbre de la vie’.
A l’époque de Darwin, on commença par comparer les espèces sur la base de leur morphologie – analyses de la taille, de la forme et de la structure des os, la présence de poils ou d’écailles ou, pour les plantes, la position des feuilles sur une tige, par exemple. Plus les caractéristiques morphologiques de 2 espèces sont similaires, plus leur ancêtre commun est récent.
Aujourd’hui, il est possible d’étudier l’évolution des espèces en comparant leur ADN et en particulier, leurs gènes ou leurs protéines. Plus l’ADN de 2 espèces est similaire, plus leur ancêtre commun est récent.

Comment sont fabriquées les protéines, ces incroyables petites machines du vivant,  essentielles au bon fonctionnement de tous les organismes ? Quel est le lien entre l’ADN, les gènes,  les protéines et l’évolution ?

C’est quoi l’ADN ? C’est quoi un gène ? C’est quoi une protéine ? A quoi ressemblent ces données aujourd’hui ?

Cellule, chromosome et ADN

Tous les organismes vivants sont constitués de cellules.

Chaque cellule contient des chromosomes.

Qui a le plus grand nombre de chromosomes ?

nom commun

bactérie E.coli

poisson rouge fougère

Ophioglossum

chimpanzé homme banane

fourmi australienne

nombre de chromosomes (2n)

1

100 1’440 48
46
11

1/2*

Icon Bacterie Icon Fish Icon Fougère Icon Monkey Icon Human Icon Banana Icon Fourmi
*Les femelles, diploïdes, possèdent 2 chromosomes ; les mâles, haploïdes, n’en ont qu’un seul.
Source: wikipedia

Chromosome, ADN et génome

Un chromosome peut être comparé à une pelote plus ou moins compacte dont le fil serait l’ADN.

Adaptation d’une image Wikimedia Commons

L’ADN a le plus souvent une structure caractéristique en ‘double hélice’ composée de deux brins. Chaque brin est une longue molécule constituée d’une succession de 4 nucléotides, appelés A (adénine), T (thymine), G (guanine) et C (cytosine). Les 2 brins sont complémentaires:
un A sur un brin est face à un T dans l’autre brin, un G est face à un C.

L’ADN est universel: il est retrouvé chez tous les organismes vivants ! Il est également retrouvé chez certains virus, parfois sous une forme un peu différente (ADN simple brin).

Quelle est la séquence du chromosome 3 de la banane ? Quel est la longueur du chromosome 1 de l'homme en centimètre ?

Début de la séquence du chromosome 3 de la banane (longueur totale: 30’470’407 pb; 1 cm).

Si vous cliquez sur le lien, vous aurez accès à la séquence complète.

>NC_025204.1
ACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAA
ACCCTAAACCCTAAACCCTAAAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCT
AAACCCTAAACCCTAAAACCAAAAAAAATGGAATAATTACTTTAAATCTTAATTATTCCTTTATTTTTGT
TTTTTTTTTTTTTAATCTTGATGCCCGATTACCCGATATGTCGGCTGGGCGGGCGCTTGGACATTGCGCT
CGTTGGGCCCAACCTGTGCTGGGCTTTTGCGTCGGCCTTTTCAATGTACTGGGTCAAACCTGAGTCATGA...

Début de la séquence du chromosome de la bactérie E.coli (longueur totale: 4’646’332 pb; 0.15 cm)

>AP009048.1
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAA
TATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC
ATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAG
CCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA...

Un morceau de séquence du chromosome 1 de l’homme (longueur totale: 248’956’422 pb; 8.2 cm).

>CM000663.2
GGTAGAACCTCAGTAATCCGAAAAGCCGGGATCGACCGCCCCTTGCTTGCAGCCGGGCACTACAGGACCC
GCTTGCTCACGGTGCTGTGCCAGGGCGCCCCCTGCTGGCGACTAGGGCAACTGCAGGGCTCTCTTGCTTA
GAGTGGTGGCCAGCGCCCCCTGCTGGCGCCGGGGCACTGCAGGGCCCTCTTGCTTACTGTATAGTGGTGG
CACGCCGCCTGCTGGCAGCTAGGGACATTGCAGGGTCCTCTTGCTCAAGGTGTAGTGGCAGCACGCCCAC
CTGCTGGCAGCTGGGGACACTGCCGGGCCCTCTTGCTCCAACAGTACTGGCGGATTATAGGGAAACACCC...

Note: des ‘N’ peuvent être retrouvés dans les séquences: cela signifie que l’on n’a pas réussi à identifier les nucléotides lors du séquençage.

La taille des génomes, exprimée le plus souvent en paire de bases (pb) ou en millions de bases (Mb), est très variable d'un organisme à l'autre. Et ce n'est pas toujours l'organisme que l'on pense qui a le plus grand génome !

Qui a le plus grand génome ?

nom commun bactérie
E.coli
virus
SARS-CoV-2
mouche plante
Paris japonica
homme banane
taille du génome (pb) 4’646’332 29’903 143,7 millions
150 milliards 3 milliards 472,2 millions
Icon Bacterie Icon Virus Icon Mouche Icon Paris Icon Human Icon Banana
Note: il s’agit de la taille du génome ‘haploïde’: pour l’homme, par exemple, 3 milliards de pb correspondent à la séquence de  23 chromosomes.
Source:
E.coli: NCBI Genome; SARS-COV-2: NCBI Genome; Drosophila Melanogaster: NCBI Genome; Paris japonica: Harvard Bionumber; Homo sapiens: NCBI Genome; Banana: NCBI Genome

Pourquoi est-ce si important de connaître la séquence des génomes ?
Parce que les génomes contiennent l’information nécessaire à la construction des organismes et en particulier à la construction des protéines, ces incroyables petites machines du vivant, essentielles au bon fonctionnement de tous les organismes…

ADN et gènes

L’ADN est le support de l’information génétique: l’ordre dans lequel s’enchaînent les nucléotides est très important. Un peu comme un livre de cuisine, l’ADN contient un certain nombre de recettes, appelées ‘gènes’. Nous allons nous intéressés aux gènes qui codent pour des protéines.

Le gène = une recette pour fabriquer une (ou plusieurs) protéine(s)

Qui a le plus grand nombre de gènes codant pour des protéines ?

nom commun bactérie
E.coli
nématode
C.elegans
banane chimpanzé homme
nombre de gènes (protéine) 4’140 20’356 36’439 23’534 20’430
Icon Bacterie Icon Worm Icon Banana Icon Monkey Icon Human
Le nombre de gènes varie en fonction des sources et peut changer au cours du temps!
Source:
E coli: OMA; C. elegans: OMA ; Banana: OMA; Chimp: OMA; Human: OMA 

Chez les eucaryotes, les gènes ne sont pas ‘continus’: ils sont composés de région(s) codante(s), les exons, (en rouge), qui sont traduites en séquence d’acides aminés, et de régions non codantes (introns). Lors de la synthèse des protéines, les introns sont éliminés.

Trouver les gènes (et les exons) dans les génomes des différents organismes est aujourd’hui encore un défi majeur !

Voici un morceau d’ADN localisé sur le chromosome 11 humain qui correspond au gène codant pour la protéine insuline.

Protéines

Les protéines sont essentielles à la vie de toutes les cellules et de tous les organismes !

Bande dessinée: Une protéine ? Une quoi ?

Lorsque la cellule ou l’organisme a besoin d’une protéine, le gène correspondant va tout d’abord être copié.

La copie, appelée ARN messager (ARNm), est transmise ensuite aux ribosomes, des machines à fabriquer des protéines qui se trouvent à l’intérieur de toutes les cellules.

Un gène peut coder pour plusieurs protéines

L’ARN subit un processus de maturation qui va conduire en particulier à l’élimination des introns. Ce processus est appelé ‘épissage’.
Il peut être alternatif: la combinaison des exons présents au final peut être différente selon les ARNm. Un gène peut produire différents ARNm…et donc différentes protéines.
Un des exemples les plus extrêmes est le gène Dscam de la drosophile: ce gène est composé de 95 exons alternatifs et peut produire jusqu’à 38’000 protéines différentes, soit plus de protéines différentes que le nombre de gènes! (Source: Role of RNA secondary structures in regulating Dscam alternative splicing (2019)).
Dans le cadre des études de l’évolution au niveau moléculaire, les biologistes associent chaque gène avec une protéine représentative (‘canonique’, consensus). C’est la raison (non-biologique !) pour laquelle, très souvent, les mots gène ou protéine sont utilisés indifféremment pour parler de gène ou de protéine en commun entre différentes espèces !

Le ribosome va ‘traduire’ la séquence de nucléotides de l’ARN messager en séquences d’acides aminés et permettre ainsi la naissance d’une protéine.

Les protéines sont en effet constituées d’une chaîne d’acides aminés.
Il existe 20 acides aminés différents, symbolisés aussi par des lettres (G, E, N, I, A, L, …) : 3 lettres ‘nucléotide’ (codon), correspondent à une lettre ‘acide aminé’.

Les biologistes utilisent le code génétique pour traduire une séquence de nucléotides en séquence d’acides aminés. Voici une représentation du code génétique, qu’il faut lire en partant depuis le milieu vers l’extérieur. Exemple, le codon GTG code pour l'acide aminé V (Val, Valine).

Une fois synthétisée, la chaîne d’acides aminés se replie sur elle-même pour adopter une structure 3D qui lui est spécifique et qui sera essentielle au bon fonctionnement de la protéine.

Voici différentes représentations de la structure 3D de la protéine BRAF, composée de 766 acides aminés, avec la position des acides aminés: L, A , T, V, K.

Protéines et fonctions biologiques

Les protéines ont des tailles, des formes et des fonctions très variées.

Certaines protéines ne sont retrouvées que chez certaines espèces :
- les protéines impliquées dans la photosynthèse, par exemple, ne sont retrouvées que chez les plantes, les algues et les cyanobactéries;
- les protéines impliquées dans la vision ne sont pas présentes chez les plantes, ni chez les algues, ni les cyanobactéries…

Les protéines qui sont retrouvées chez un grand nombre d’espèces sont impliquées dans des processus biologiques universels comme, par exemple, la synthèse des protéines ou la réplication de l‘ADN.

Ces protéines (ou les gènes correspondants) sont très utiles pour étudier l'évolution !

Print Friendly, PDF & Email

What did you think?

Loading spinner