« Back to Glossary Index
« Back to Glossary Index
A DNA sequence is a succession of 4 nucleotides, symbolised by the letters A, T, C, G (G=guanine): ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCC… A protein sequence is a succession of 20 amino acids, symbolised by the letters G, E, N, I, A, L, …(G = Glycine), in an order that is specific to each protein: MALWMRLLPLLALLALW…