//show holiday modal during set period and only once Skip to main content

Die älteste bisher sequenzierte DNA stammt von drei Backenzähnen von drei Mammuts, die vor 1,25 bis 2,08 Millionen Jahren lebten. Diese Backenzähne wurden im Nordosten Sibiriens gefunden.

>DQ1888299.2 Mammuthus primigenius mitochondrion, complete genome
GTTAATGTAGCTTAAAACAAAAGCAAGGTACTGAAAATACCTAGACGAGTATATCCAACTCCATAAACAACAAAGGTTTGGTCCCGGCCTTCTTATTGGTTACTAGGAAACTTATACATGCAAGTATCCGCCCGCCAGTGAATACGCCTTCTAAATCATCACTGATCAAAGAGAGCTGGCATCAAGCACACACCCCAAGTGTAGCTCATGACGTCTCGCCTAGCCACACCCCCACGGGAAACAGCAGTAGTAAATATTTAGCAATTAACAAAAGTTAGAC...

 

Quelle: Million-year-old DNA sheds light on the genomic history of mammoths (2021)

Print Friendly, PDF & Email