//show holiday modal during set period and only once Skip to main content

Sequenz

« Back to Glossary Index

Eine DNA-Sequenz besteht aus der Abfolge von 4 Nukleotiden, symbolisiert durch die Buchstaben A, T, C, G (G=Guanin): ATGGCCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCC… Eine Proteinsequenz besteht aus der Abfolge von 20 Aminosäuren, symbolisiert durch die Buchstaben G, E, N, I, A, L, … (G = Glycin), in einer Reihenfolge, die für jedes Protein spezifisch ist: MALWMRLLPLLALLALW … 

 

Print Friendly, PDF & Email
Synonyms:
Sequenzen
« Back to Glossary Index